Detail of EST/Unigene TCMT59016
Acc. TCMT59016
Internal Acc.
Type TC/Unigene
Annotation (Top 5 hits in Uniprot_trembl) Metal tolerance protein 11 OS=Arabidopsis thaliana E-value=0; Metal tolerance protein 5 OS=Oryza sativa subsp. japonica E-value=0; Metal tolerance protein 6 OS=Oryza sativa subsp. japonica E-value=0; Metal tolerance protein 9 OS=Arabidopsis thaliana E-value=0; Metal tolerance protein 10 OS=Arabidopsis thaliana E-value=0;
Length 3321 nt
Species Medicago truncatula
Belonged EST Libraries MT_INSECT (4 ESTs); MTUS_MIXTISSUE (4 ESTs); MT_JCVI-MT1 (2 ESTs); MT_FLOSEED_MTY (2 ESTs); MT_NOD_GVSN (2 ESTs); MT_JCVI-MT2 (2 ESTs); MT_NOD_ROOT (1 ESTs); MT_DLEAF (1 ESTs); MT_GPOD (1 ESTs); MT_PhoLEAF (1 ESTs); MT_CDS (1 ESTs);
Sequence CTTACCTTATACATTATTCACTCACACACATTTCCCACTTTTCCGGTTCAAAAAAAAAAC
CGAAAAAAATCTTCTACGGAACCTCGGTACTATAACAAAGAACAAACCTACCTGCATTTT
CTCTTCTTCTTCTTCTTCTTTGTTTAGTCAACTAAAAACGACGACGTTTTTAGAATGACC
GGGAAAATGGTGGAGACGGTGGAGCAATCTAACGAAGAAGAGCTTTCTCTTCTTTCAGTT
TCAGATAATGGTGACCGGTCATGGCGGTTGAACTTCGACTCTTTTCAGTTGAATTCTCAG
CATACTGAAAAGACACCTAAACCCTCTTCTGGTATTCATGACTGCTATGGTGTTCTTGGT
CAAGAAGATAATATTGCTGAGTACTATCAGCAGCAGGTTGAAGTGCTTGAGGGCTTTACT
GAAATGGATGCCTTAGCTGAACGTGGTTTCATTCCCGGAATGTCAAAGGAGGAGCGAGAC
AAATTAGCCAGGAGCGAGACGTTTGCCATCAGAATATCGAACATAGCAAACATGGTTCTT
TTTACTGCCAAAGTTTATGCATCAGTCAGAAGTGGCTCCCTAGCCATCATTGCATCTACT
TTAGACTCTCTTCTGGACCTCCTTTCTGGATTTATCTTATGGTTCACTGCATTTTCCATG
CAAACACCAAACCCATATCAGTACCCTATTGGAAAGAAGCGGATGCAACCATTGGGAATT
CTGGTTTTTGCCTCTGTCATGGCAACACTAGGGCTGCAAATAATTTTGGAGTCTGCCCGC
ACACTAATATACACCGATAATACCTTCAGCTTGACTAGGGAACAGGAGCGCTGGGTTGTG
GGTATTATGCTTTCAGTGACTTTGGTGAAATTCATGCTAATGATTTATTGCCGCTCTTTT
ACTAATGAGATTGTAAAGGCCTATGCTCAGGATCACTTTTTTGATGTGATCACTAATGTG
ATTGGTCTAATTGCTGCACTTTTGGCCAATTATTTTGATGATTGGATGGATCCTGTTGGT
GCTATCATTCTGGCTTTGTACACAATTCGCACATGGTCAATGACAGTGTTGGAAAATGTG
AATTCACTTGTTGGAAGATCAGCTGCACCTGAGTATCTTCAGAAACTTACATACCTCTGC
TGGAACCACCACAAGGCTGTGAGGCACATTGACACAGTTCGAGCTTACACATTTGGGTCA
CACTACTTTGTTGAGGTTGATATCGTCCTTCCAGCAGACATGCCTTTACAAGAGGCTCAT
GATATCGGGGAATCATTGCAAGAGAAGCTCGAACTTTTGCCTGAGATTGAGCGTGCTTTT
GTTCATCTCGATTATGAATTCAGTCACAAACCTGAGCATGCACAAGCACATTCTTAGCAG
CAATGTGAAAAGCAATGCTGACTTGCGATTTTCAGATGTAAATGTGAAATATTTTAGTTA
GATCTGAATCCGTACTAAGTACTGCGAAATTGTTGAGAGCTGTAGAATATGCTGTGCAGC
CTATCATGTAAGGAAAATTATTCTCTCCTCTTTCACTCTATTTTCGTATTTATTATGTGT
AGAAGATATTTGTACCCTACCTAATGTCGAAGTATCATGTTTATATTCTAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAANGGGGAGGGCCTCGTGCCGAATTCGGCACGAGGGCAGTATA
TAGTCACAGATTCATTCAATCACTTACACCAACTCACACGCAACACAATACAATTATAAA
CAAGGAAAAATCAAAGAACATCAAGAGCAAAAAACATGATCCATCAAAAACAAATGCTGC
ACCACTTCAAATTCTCTACCACTGTCTATGTTTTCTTTTGCTTCACACTAATTATAACCA
TAATAACAACTCAAGCAGCTACAGACCTATCCTTCATCCAGAGTTACTGTCCAAACACAA
ACACTTTTTCTTCAAACACAACCTACCAAACAAACCTCAACAAACTTCTTTCTATTCTTT
CATCCAACTCCACAAACATGCTAGAAACCAATTTGTTTGTTAAATTTAAGTTGCTTTAAT
TTTATGATAATACGCAGATCCTGAAAAAGCACATCAGATAAATTGGCCAAGACGATACAA
GATAATAGAAGGAATTGCCCGTGGAATGCTTTATCTTCACGAAGATTCTCGACTTAGAAT
CATACATCGCGATCTTAAAGCTAGTAATATATTATTAGATGAGAATTTAAATCCCAAAAT
TTCAGATTTTGGGATGGCAAGAATATTTGGTGTTGATCAAACTCGAGGAATCACAAACAG
AGTTGTTGGAACATTGGGTTACATGTCTCCAGAGTATGCAATGCACGGAGAATTTTCTAT
CAAAACAGATGTGTATAGCTTTGGTGTCCTCGTTCTCGAGATAATTACCGGAAAGAAGAT
CACATCCTTTCGCGAATCAGGCTACGCCGAGGACCTTTTGAGCTATGTGAGTTAATTTGA
TCTAACTGAACATTTTTTAGTATCAAGTAATGAATGAATAGAAATTTTGGAGGCAACCAA
AATTTATTGTTCATTTCTTACTATTACTATTATTTGATTTGATTTCAAAACACTTCGTGC
GGAGAAGAATGGTATTGCGGGTTTGATCCTGAACCCTAACACATCAAATGTCTCCAACTA
CTTTAACTATCTCAGCTGCACGTACGGGACTGTTTCTTGATTCATACCTAAATAAACAAA
GCGTATTATTTTCAGGCTTGGAAAAAATGGAATGATGGGACACCATTAGAGTTACTGGAC
ATGACATTGAGAGATTCATACACAAGTGTTGAAGTAACAAGATGCATCCATGTTGGGTTA
TGTTGTGTTCAAGAAGATCCAGATCAAAGACCATCGATGCAGACAGTAGTTTTACTGCTA
AGTAGCCATTCTGTTACTCTTGAACCACCTCAACGACCAGCGGGTTATATTAGTAGCAAA
ACTGATCAAAGCTTTGCAACAAAAGATTTTGATAGCTCAGACAAGTCTACATCTAAAAGC
CAATCGGTTGCAGTTTCTGTTGATGATGCATCCATCACTCAGGTGTACCCTCGATAGTGC
TTCTACTCACTAGGTGTACCATCTATGCAGTAGCTTTGGCTGCCCCATTCTTTTTACTCT
TATTTGAATAATTTGGCATATCTTGTAATTAGCTACCCAATAAAATATATTTAGCTACCA
CAAATGTGCTTATTTGTCAAAAATTAGTAGAAGTGAGAAAGTCAAAAGATATTAATTTGT
TTGATAGATGTATTATACCTTATTTCGAAAATTTTGATCCCATAAACAAGGATAATTTTA
GGTAGACACCCTTTTTGACCC
EST members of Unigene BT051598  CF069917  CF069908  CA920241  CA920232  EV261740  EV255013  DW018725  DW016488  BE998167  BE998164  AW684285  BQ151535  CA917875  BI263615  BI268402  BI268166  BI267507  BG449878  GE349895  GE344867 
InterProScan Domain  
Gene Ontology  
KEGG Orthology
EC 2.7.11.1 
Transcription Factor Family WRKY
Transporter Classification Family 1.A.2 Animal inward-rectifier K+ channel IRK-C; 1.A.26 Plant plasmodesmata PPD
Probeset Mtr.12572.1.S1_at, Mtr.43418.1.S1_s_at
Corresponding NCBI Gene 818530 
Trichome-related Gene from Literature 818530